We recently demonstrated different that the mitogen-activated protein kinase (MAPK) MEK/ERK1/2 signaling inhibition could alter the expression level of ��6D in hepatocellular carcinoma cell line HepG2 [13]. It has previously been shown that inhibition of ERK1/2 signaling had no apparent effect on PPAR�� agonist-mediated increase in glucose uptake in cultured human skeletal muscle, whereas PPAR�� agonist increased both phosphorylation and expression of ERK 1/2[14]. Thus, it is possible that both Erk1/2 signaling and PPAR�� are involved in a crosstalk contributing to the regulation of ��6D expression.Several lines of evidence suggest that PPAR�� activity and Erk1/2 signaling play important role in the regulation of pancreatic ��-cells function.

In the present study in human pancreatic carcinoma cell line PANC-1, ��6D expression was tested for responsiveness to the synthetic PPAR�� agonist GW0742, under either MEK/ERK1/2 or epidermal growth factor receptor (EGFR) signaling pathway blockade.2. Materials and Methods2.1. MaterialsCell culture materials, media, and FBS were obtained from Sigma Chemicals Company (St. Louis, Mo, USA). GW0742 and PD98059 were purchased from Cayman Chemicals (Ann Arbor, MI, USA). PANC-1 cell line was obtained from the Pasteur Institute Culture Collection in Tehran, Iran. All other chemicals used were of analytical grade.2.2. Cell CulturePANC-1 cells were grown in RPMI1640 containing 10% FBS, L-glutamine (2mM), penicillin (100units/mL), and streptomycin (100��g/mL) at 37��C, 5% CO2/95% humidity. The subcultures with less than 8 passages were used for drug treatment experiments.

The cells were seeded at a density of 2 �� 105/well in a 6-well plate. After allowing the cells to attach overnight, the medium was replaced with fresh medium containing ��PPAR�� agonist GW0742, specific inhibitor of the MEK/ERK1/2 PD98059, or selective inhibitor of EGFR AG1478. Following 48h incubation, culture medium was removed; the cell monolayer was washed and collected for mRNA and protein expression analysis.2.3. Real-Time RT-PCR AnalysisTotal RNAs were purified with QIAamp RNA mini kit with a DNase I treatment (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Total RNAs were then resuspended in 50��L of RNase-free water and stored at �C80��C.

For cDNA synthesis, RNA (1��g) was reverse transcribed with a first-strand Drug_discovery cDNA synthesis kit for reverse-transcription polymerase chain reaction (RT-PCR; Roche, Hertfordshire, UK).FADS2 primers [15] for real-time PCR were designed to amplify a segment in the cDNA sequence as follows: forward primer TTACAACATCACCAAATGGTCCAT, the intronspanning reverse primer GAAGGCATCCGTTGCATCTT, and the labeled probe CCAGCGGGTCATCGGGCACTAC. The TaqMan probes were labeled with a reporter dye (FAM) on its 5�� end and a quencher dye (TAMRA) on its 3�� end.