RRAM devices containing materials such as HfO x [5, 6], SrTiO3[7], TiO2[8, 23], ZrO2[24, 25], Na0.5Bi0.5TiO3[26], NiO x [27], ZnO [28, 29], TaO x [30, 31], and AlO x [32, 33] have been reported. However, GeO x has only been used in RRAM as Ni/GeO x /SrTiO x /TaN [34] and Cu/GeO x /W [35] structures and in Ge-doped HfO2 films [36]. RRAM devices containing nanotubes and Si NWs have also been reported [37–39]. Although 3-MA price many switching materials and structures have been developed, the switching mechanism of RRAM devices remains unclear despite it being very important for application

of RRAM. Ge/GeO x NWs in an IrO x /Al2O3/Ge NWs/SiO2/p-Si metal oxide semiconductor (MOS) structure MAPK inhibitor have not been reported either. Because of the self-limitation of current compliance (CC < 20 μA) in MOS structures, here we fabricate an IrO x /GeO x /W metal-insulator-metal (MIM) structure to understand how the resistive switching mechanism involves oxygen ion migration through the porous IrO x electrode.

It is also important to investigate the scalability potential of RRAM devices. The size of devices is typically limited by equipment or cost, so the diameter of conducting pathways could be investigated using switching characteristics or leaky pathways rather than by fabricating large-scale devices. We believe the feature size of RRAM devices and their scalability potential will be considered the same as the diameter of the minimum conduction path in the future. We previously investigated the effect of nanofilament diameter on the properties of CBRAM devices [12]. However, a method to investigate the diameter of conducting paths in RRAM devices has not been developed. In this work, we determine the diameter of Ge/GeO x nanofilaments in a GeO x film within a MIM structure under SET operation using a new method. The results suggest that Ge/GeO x NWs form

under SET operation in the GeO x film. In this study, the growth of Ge NWs using the vapor–liquid-solid Histone demethylase (VLS) technique is investigated. The fabricated core-shell Ge/GeO x NWs are characterized by field emission scanning electron microscopy and high-resolution transmission electron microscopy. Defects in the Ge/GeO x NWs are observed by X-ray photoelectron spectroscopy (XPS) and photoluminescence (PL) spectroscopy at 10 to 300 K. The resistive switching memory of the Ge/GeO x NWs in an IrO x /Al2O3/Ge NWs/p-Si structure with a self-limited low current of <20 μA is determined. The mechanism of resistive switching involves oxygen ion migration, which is observed by the evolution of oxygen gas on the top electrode (TE) in an IrO x /GeO x /W structure under sufficient applied voltage.

Infect Immun 2011,79(6):2154–2167.PubMedCentralPubMedCrossRef 15. Gardete find more S, Wu SW, Gill S, Tomasz A: Role of VraSR in antibiotic resistance and antibiotic-induced stress response in Staphylococcus aureus. Antimicrob Agents Chemother 2006,50(10):3424–3434.PubMedCentralPubMedCrossRef

16. Meehl M, Herbert S, Gotz F, Cheung A: Interaction of the GraRS two-component system with the VraFG ABC transporter to support vancomycin-intermediate resistance in Staphylococcus aureus. Antimicrob Agents Chemother 2007,51(8):2679–2689.PubMedCentralPubMedCrossRef 17. Hiron A, Falord M, Valle J, Debarbouille M, Msadek T: Bacitracin and nisin resistance in Staphylococcus aureus: a novel pathway involving the BraS/BraR two-component system (SA2417/SA2418) and both the BraD/BraE and VraD/VraE ABC transporters. Mol Microbiol 2011,81(3):602–622.PubMedCrossRef 18. Howden BP, McEvoy CR, Allen DL, Chua K, Gao W, Harrison PF, Bell J, Coombs G, Bennett-Wood V, Porter JL, et al.: Evolution of multidrug resistance during staphylococcus aureus infection involves mutation of the essential CHIR-99021 Two component regulator WalKR. PLoS Pathog 2011,7(11):e1002359.PubMedCentralPubMedCrossRef 19. Shoji M, Cui L, Iizuka R, Komoto A, Neoh HM, Watanabe Y, Hishinuma T, Hiramatsu K: WalK and clpP mutations confer reduced vancomycin

susceptibility in Staphylococcus aureus. Antimicrob Agents Chemother 2011,55(8):3870–3881.PubMedCentralPubMedCrossRef 20. Sun J, Zheng L, Landwehr C, Yang J, Ji Y: Identification

of a novel essential two-component signal transduction system, YhcSR, in Staphylococcus aureus. J Bacteriol see more 2005,187(22):7876–7880.PubMedCentralPubMedCrossRef 21. Yan M, Yu C, Yang J, Ji Y: The essential two-component system YhcSR is involved in regulation of the nitrate respiratory pathway of Staphylococcus aureus. J Bacteriol 2011,193(8):1799–1805.PubMedCentralPubMedCrossRef 22. Sun F, Ji Q, Jones MB, Deng X, Liang H, Frank B, Telser J, Peterson SN, Bae T, He C: AirSR, a [2Fe-2S] cluster-containing Two-component system, mediates global oxygen sensing and redox signaling in staphylococcus aureus. J Am Chem Soc 2012,134(1):305–314.PubMedCentralPubMedCrossRef 23. Yan M, Hall JW, Yang J, Ji Y: The essential yhcSR Two-component signal transduction system directly regulates the lac and opuCABCD operons of staphylococcus aureus. PLoS One 2012,7(11):e50608.PubMedCentralPubMedCrossRef 24. Shang F, Xue T, Sun H, Xing L, Zhang S, Yang Z, Zhang L, Sun B: The Staphylococcus aureus GGDEF domain-containing protein, GdpS, influences protein A gene expression in a cyclic diguanylic acid-independent manner. Infect Immun 2009,77(7):2849–2856.PubMedCentralPubMedCrossRef 25. Xue T, Zhao L, Sun B: LuxS/AI-2 system is involved in antibiotic susceptibility and autolysis in Staphylococcus aureus NCTC 8325. Int J Antimicrob Agents 2013,41(1):85–89.PubMedCrossRef 26.

J Bacteriol 1999,181(18):5825–5832.PubMed 33. John J, Frech M, Wittinghofer A: Biochemical properties of Ha-ras encoded p21 mutants and mechanism of the autophosphorylation reaction. J Biol Chem 1988,263(24):11792–11799.PubMed 34. Sood P, Lerner CG, Shimamoto T, Lu Q, Inouye M: Characterization of the autophosphorylation of Era, an essential

Escherichia coli GTPase. Mol Microbiol 1994,12(2):201–208.PubMedCrossRef MAPK Inhibitor Library purchase 35. Malen H, Pathak S, Softeland T, de Souza GA, Wiker HG: Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv . BMC Microbiol 2010, 10:132.PubMedCrossRef 36. Wolfe LM, Mahaffey SB, Kruh NA, Dobos KM: Proteomic definition of the cell wall of Mycobacterium tuberculosis . J Proteome Res 2010,9(11):5816–5826.PubMedCrossRef 37. Datta K, Skidmore JM, Pu K, Maddock JR: The Caulobacter crescentus this website GTPase CgtAC is required for progression through the cell cycle and for maintaining 50 S ribosomal subunit levels. Mol Microbiol 2004,54(5):1379–1392.PubMedCrossRef 38. Tan J, Jakob U, Bardwell JC: Overexpression of

two different GTPases rescues a null mutation in a heat-induced rRNA methyltransferase. J Bacteriol 2002,184(10):2692–2698.PubMedCrossRef 39. Datta K, Fuentes JL, Maddock JR: The yeast GTPase Mtg2p is required for mitochondrial translation and partially suppresses an rRNA methyltransferase mutant, mrm2. Mol Biol Cell 2005,16(2):954–963.PubMedCrossRef 40. Lapik YR, Misra JM, Lau LF, Pestov DG: Restricting conformational flexibility of the switch II region creates a dominant-inhibitory phenotype in Obg GTPase Nog1. Mol Cell Biol 2007,27(21):7735–7744.PubMedCrossRef 41. Scott JM, Haldenwang WG: Obg, an essential GTP binding protein of Bacillus subtilis , is necessary for stress activation of transcription factor sigma(B). J Bacteriol 1999,181(15):4653–4660.PubMed 42. Parida BK, Douglas

T, Nino C, Dhandayuthapani S: Interactions of anti-sigma factor antagonists Etomidate of Mycobacterium tuberculosis in the yeast two-hybrid system. Tuberculosis (Edinb) 2005,85(5–6):347–355.CrossRef 43. Beaucher J, Rodrigue S, Jacques PE, Smith I, Brzezinski R, Gaudreau L: Novel Mycobacterium tuberculosis anti-sigma factor antagonists control sigmaF activity by distinct mechanisms. Mol Microbiol 2002,45(6):1527–1540.PubMedCrossRef 44. Hecker M, Volker U: General stress response of Bacillus subtilis and other bacteria. Adv Microb Physiol 2001, 44:35–91.PubMedCrossRef 45. Ausubel F, Brent R, Kingston R, Moore D, Seidman J, Smith J, Struhl K: Current Prtocols in Molecular Biology. New York: Wiley; 1989. 46. Stover CK, de la Cruz VF, Fuerst TR, Burlein JE, Benson LA, Bennett LT, Bansal GP, Young JF, Lee MH, Hatfull GF, et al.: New use of BCG for recombinant vaccines. Nature 1991,351(6326):456–460.PubMedCrossRef 47. Mueller-Ortiz SL, Wanger AR, Norris SJ: Mycobacterial protein HbhA binds human complement component C3. Infect Immun 2001,69(12):7501–7511.

Minimum inhibitory concentration (MIC) determination The MICs of selleck compound all relevant strains in RDM to tigecycline, (gift from Wyeth Pharmaceuticals, US), tetracycline (Sigma-Aldrich, UK), ciprofloxacin and ampicillin (Sigma-Aldrich, UK) were determined and interpreted according to the BSAC protocols [51]. In order to check whether concentrations at half the MIC would induce stress

response rather than kill the cells in liquid medium, half of the MIC of the antibiotic was added to liquid culture at OD600 = 0.6 (sterilised water was added to the control). After growth for an hour or overnight, an aliquot of the culture was taken and spread on plates, to determine colony forming unit per ml (cfu/ml). Additionally growth curves were also generated based on the OD600 readings. The stress DAPT molecular weight response was confirmed by comparison of the antibiotic challenged cells to the control on both the growth curves

and the cfu/ml. RNA extraction Cells were grown to OD600 = 0.6 prior to the addition of the antibiotic. After 1 hour of exposure, cells were harvested by centrifugation. The cell pellet was then resuspended in TRIzol reagent (Invitrogen) and the total RNA was extracted according to Santhakumar et al.[52]. The resulting pellet was washed and resuspended in an appropriate amount of DEPC (Sigma, UK) treated water. cDNA library construction The cDNA library was constructed (according to the manufacturer’s instruction) using the Exact START Small RNA Cloning kit from Epicentre (Cambio,

UK). Briefly, total RNA was digested with DNase I to remove any contaminating DNA, and small RNAs were enriched with Epicentre enrichment solution by precipitating RNA molecules longer than 200 nts. The enriched RNAs were treated with phosphatase (Cambio, UK) to convert 5’ triphosphate group of RNA molecules to 5’ monophosphate, and a poly-A tail was added to the 3’ end (according to the manufacturer’s instruction). The 5’ Lepirudin end of RNA was ligated with Acceptor Oligo that carries a NotI restriction site. Reverse transcription was performed to yield first cDNA strand, using a primer with poly-T at its 3’ end to cover the poly-A tail of RNA samples, and an AscI restriction site. After RNase digestion, the sample was subject to a PCR with Small RNA PCR Primer 1 and 2. The product was digested by NotI and AscI (New England Biolabs) and was subsequently cloned into the cloning-ready pCDC1-K vector (Cambio, UK). Since the 5’ ligation adaptor differs from the 3’ ligation adaptor, the cloning of these putative small RNA molecules is directional. All oligonucleotides used in this study are listed in Table 3.

Int J Food Microbiol 2010,136(3):345–351.PubMedCrossRef 19. Koo OK, Aroonnual A, Bhunia AK: Human heat-shock protein 60 receptor-coated paramagnetic beads show improved capture of Listeria monocytogenes in the presence of other Listeria in food. J Appl Microbiol 2011,111(1):93–104.PubMedCrossRef 20. Meldrum RJ, Ellis MK-8669 solubility dmso PW, Mannion PT, Halstead D, Garside J: Prevalence of Listeria monocytogenes in ready-to-eat foods sampled from the point of sale in Wales, United Kingdom. J Food Prot 2010,73(8):1515–1518.PubMed 21. Carvalheira A, Eus bio C, Silva J, Gibbs P, Teixeira P: Influence of L. innocua on the growth of L. monocytogenes. Food Control 2010,21(11):1492–1406.CrossRef 22. Byrne B, Stack E,

Gilmartin N, Kennedy RO: Antibody-based sensors: Principles,

problems and potential for detection of pathogens and associated toxins. Sensors 2009,9(6):4407–4445.PubMedCrossRef 23. Bhunia AK, Johnson MG: Monoclonal antibody specific for Listeria monocytogenes associated with a 66-kilodalton cell surface antigen. Appl Environ Microbiol 1992,58(6):1924–1929.PubMed 24. Bhunia AK, Ball PH, Fuad AT, Kurz BW, Emerson JW, Johnson MG: Development and characterization of a monoclonal antibody specific for Listeria monocytogenes and Listeria innocua. Infect Immun 1991,59(9):3176–3184.PubMed 25. Kim SH, Park MK, Kim JY, Chuong PD, Lee YS, Yoon BS, Hwang KK, Lim YK: Development of a sandwich ELISA for the detection of Listeria spp. using specific Montelukast Sodium flagella antibodies. J Vet Sci 2005,6(1):41–46.PubMed

26. Heo SA, Nannapaneni R, Story RP, Johnson MG: Characterization of new hybridoma clones producing monoclonal antibodies reactive against both live and heat-killed Listeria BTK inhibitor libraries monocytogenes. J Food Sci 2007,72(1):M008-M015.PubMedCrossRef 27. Lin M, Armstrong S, Ronholm J, Dan H, Auclair ME, Zhang Z, Cao X: Screening and characterization of monoclonal antibodies to the surface antigens of Listeria monocytogenes serotype 4b. J Appl Microbiol 2009,106(5):1705–1714.PubMedCrossRef 28. Paoli GC, Chen CY, Brewster JD: Single-chain Fv antibody with specificity for Listeria monocytogenes. J Immunol Methods 2004,289(1–2):147–155.PubMedCrossRef 29. Lathrop AA, Banada PP, Bhunia AK: Differential expression of InlB and ActA in Listeria monocytogenes in selective and nonselective enrichment broths. J Appl Microbiol 2008, 104:627–639.PubMedCrossRef 30. Nannapaneni R, Story R, Bhunia AK, Johnson MG: Unstable expression and thermal instability of a species-specific cell surface epitope associated with a 66-kilodalton antigen recognized by monoclonal antibody EM-7 G1 within serotypes of Listeria monocytogenes grown in nonselective and selective broths. Appl Environ Microbiol 1998,64(8):3070–3074.PubMed 31. Bhunia AK: Biosensors and bio-based methods for the separation and detection of foodborne pathogens. Adv Food Nutr Res 2008, 54:1–44.PubMedCrossRef 32. Brehm-Stecher B, Young C, Jaykus L-A, Tortorello ML: Sample preparation: The forgotten beginning.

2013, 49:5760. 10.1039/c3cc41913dCrossRef 4. Gupta AK, Gupta M: Biomaterials. 2005, 26:3995–4021. 10.1016/j.biomaterials.2004.10.012CrossRef 5. Granitzer P, Rumpf K, Tian Y, KU-60019 research buy Akkaraju G, Coffer J, Poelt P, Reissner M: Appl Phys Lett. 2013, 102:193110. 10.1063/1.4807421CrossRef 6. Tian Y, Gonzalez R, Akkaraju G, Coffer J: Presentation at Porous Semiconductors Science and Technology. Spain: Alicante-Benedorm; 2014. Abstract 06-O-15 7. Roca AG, Costo R, Rebolledo AF, Veintemillas-Erdaguer S, Tartaj P, Gonzalez Carreno T, Morales MP, Serna CJ: J Phys D: Appl Phys. 2009, 42:224002. 10.1088/0022-3727/42/22/224002CrossRef Competing interests The authors declare that they have no

competing interests. Authors’ contributions RG fabricated the SiNT samples, their loading with Fe3O4 nanoparticles, and microstructural characterization.

PG and KR performed the magnetic measurements. PG, KR, RG, JC, and MR discussed the data and prepared the manuscript. All authors read and approved the final manuscript.”
“Background Over the last decade, there has been an increasing interest in finding new highly efficient thermoelectric materials Cell Cycle inhibitor for electronic cooling [1–3] and power generation [4–6]. The energy demand in developed and under-developed countries is increasing due to the population growth and the improvement of the standard level of life in emerging countries. Unfortunately, reserves of fossil fuels are not unlimited, and their use generates huge amounts of CO 2 in the atmosphere. Many human activities (power plants, cement plants, steel mills, and vehicles engines as a few examples) are generating high amount of waste heat at different ranges of temperature. The conversion of this waste heat into electric energy would be an important contribution to the sustainable development as it would

allow to reduce both the Greenhouse gas emissions and fossil fuel consumption. Thermoelectric generators are designed to convert a temperature difference into electricity (Seebeck effect) or, inversely, electric energy into a thermal Fossariinae gradient (Peltier effect). Thermoelectric materials must have a high conversion efficiency, and they must also be composed conveniently of non-toxic and abundantly available elemental species having high chemical stability in air. The performance of a thermoelectric material is determined by the dimensionless figure of merit ZT: (1) S being the Seebeck coefficient, σ the electrical conductivity, κ the thermal conductivity, and T the absolute temperature. The power factor (PF) defined as PF≡σ S 2 can be used to compare the relative efficiency when the thermal conductivity is similar in different samples. Over the past 30 years, semiconductor alloys based on Bi 2 Te 3, PbTe, and SiGe [7–9] have been extensively studied and optimized for their use in thermoelectric applications.

All the isolates with IP-1 amplified a strong band with intI1, but only four isolates amplified strong bands for qacEΔ1. Most of the isolates with IP-1 (76%) did not amplify qacEΔ1 or produced very weak bands (16%) [see Additional file2]. This result suggests that most of these integrons contain an unusual 3′ CS, as recently reported for this integron in Salmonella and Staphylococcus [40, 49–51]. Twenty isolates that did not amplify the cassette region using the CS-F and CS-R primers were selected to test the amplification of intI1 and qacEΔ1. Most of these isolates did not produce amplifications, or produced very weak bands; only four isolates presented an intense intI1 band. Macro-restriction

PFGE dendrogram and association among molecular markers BAY 73-4506 ic50 The PFGE fingerprints were clustered

using the UPGMA algorithm. The dendrogram was divided in five clusters using a cut-off value of 78% similarity (Figure 4). Cluster I grouped all the ST213 isolates Ibrutinib manufacturer and four ST19 isolates. Using the information provided by the accessory genes, this cluster can be further subdivided in four main groups. Group Ia contained only ST213 isolates from three different states, many of which carried cmy-2 and IP-1. Groups Ib and Ic contained ST213 isolates mostly without cmy-2 and ST19 isolates without pSTV, and comprising five of the six IP-2. Group Id was similar to group Ia; it contained ST213 isolates, most of which harboured cmy-2 and IP-1. It is distinguished from groups Ia and Ib by the lack of a large restriction fragment of about 665 kb. Cluster II was formed by ST19 isolates carrying both pSTV and SGI1. Clusters III and

IV grouped ST19 isolates and the four ST302 strains, most of them carrying pSTV. Cluster IV contained the two ST19 isolates for which rck could not be amplified, and one of them carried the IP-4 integron. Finally, cluster V was composed by ST19 strains lacking pSTV. A few exceptions to these general patterns were detected, such as a cluster I ST213 Bcl-w isolate harbouring pSTV (yuhs03–80) or a ST19 isolate harbouring pSTV and SGI1 in cluster I (sorapus02–4). The whole set of genetic markers targeting both housekeeping and accessory genes allowed us to discover genetic subgroups within the isolate set. Discussion Low genetic diversity of core and accessory genes Both housekeeping and accessory genes displayed extremely low levels of genetic diversity; even the third codon positions were invariable. The low genetic diversity and the clonal pattern of descent of accessory elements could be explained by several evolutionary processes, such as rapid clonal expansion of the population, genetic drift, the existence of barriers to genetic exchange among subgroups within the population, or a combination of these possibilities [4, 5, 8, 52, 53].

The morphology of the samples was observed by scanning electron microscopy (SEM) using a Carl Zeiss (ULTRA 55, Carl Zeiss, Oberkochen, Germany) with energy dispersive X-ray (EDX, INCA PentaFET × 3, Model: 7426, Oxford Instruments, Abingdon, Oxfordshire, UK) spectrometry mode. The Raman spectra were obtained using a Senterra R200-L Raman spectrometer CX-5461 purchase (Bruker, Germany) with a 514-nm line of laser source. Results and discussion To get the morphology, composition and the degree of graphitization of CNT arrays, the resultant SEM, TEM, EDX, and Raman spectra were used for characterization. As shown in Figure 1a,

the AAO template has flat surface with the regularly periodic pore structure. After completely removing AAO template framework, the resultant CNT arrays were obtained as shown in Figure 1b. The aligned CNTs have high density in consistent RAD001 mouse with that of the template. Figure

1 SEM images of the samples. (a) AAO template and (b) CNT arrays. Figure 2 is TEM image of CNT arrays after ultrasonic dispersion. It can be observed that CNTs with the assistance of the AAO template have good opening channels with the thickness of CNT walls of 8 to 10 nm, including about 25 layers. So CNTs prepared in our experiment are multi-walled ones. Compared with other reported research results [13], the obtained CNTs have clean and smooth surface with high degree of graphitization. Figure 2 TEM images of CNT. The inset is the low magnification image. Figure 3 presents the Raman spectra of CNT arrays with two kinds of diameters (80 to 100 and 110 to 150 nm). It is noted that there are two obvious peaks in the 1,350 and 1,580 cm−1, which are the D and G peak, respectively. By comparing the intensities of two peaks, the I G/I D of CNTs is about 2, which is better than those of other works using the same method [30]. Figure 3 Raman spectra of CNT arrays. In general, the diameter of CNTs is in consistent with pore size of AAO template. The roughness of CNTs has great relation with that of the hole wall of AAO template. In previously reported CVD experiments [12], the temperature of the system was increased quickly to reaction temperature

and then immediately started the CVD experiment. In this process, the temperature directly rose from room temperature to reaction temperature; in other words, the sample SPTLC1 has always been in a rapid heat treatment condition. Part of the internal thermal stress of the template was released through high-temperature deformation, but the majority of the thermal stress could not get released due to the rapid heating process. Thermal annealing is an effective method in thermal stress release [31]. In order to improve graphitization degree of CNTs, a heat preservation pretreatment for 1 h under 500°C was added during the fast heating process so that the template could be fully stretched and the deformation stress will be released completely.

To further increase TK mediated tumor killing efficacy and

facilitate tracing TK expression, we constructed a new vector by inserting a CMV enhancer and an EGFP reporter gene into pGL3-hTERTp-TK vector, and evaluated its therapeutic efficacy in in vitro and in vivo tumor therapy. Materials and methods 1. Reagents Fetal bovine serum (FBS) was purchased from Hangzhou Sijiqing Company. PCR kit and TaqMan real time PCR kit were from Takara Bio-engineering Co., Ltd. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was from Sigma, USA; Ganciclovir (GCV) was from ROCH company. Lipofectamine 2000, DMR IE2C and Trizol were from Invitrogen. TRAPEZE® RT telomerase activity detection kit MLN0128 mouse was purchased from KeyGen (Nanjing, China). Plasmid Midi Kit

was from Heda Biotech (Guangzhou, China). All PCR primers were synthesized by Shanghai Ying-Jun Biotechnology Co., Ltd. 2. Cell lines Human nasopharyngeal carcinoma 5-8F cells (NPC 5-8F), human breast cancer cells MCF-7 Ceritinib and human vascular endothelial cells ECV were kindly provided by Department of Cell Biology, the Southern Medical University, and maintained in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum at 37°C in a 5% CO2 incubator (Shell LAB, USA) as previously reported [10]. 3. Construction of plasmid with luciferase reporter gene EGFP gene was obtained from pEGFP-N1 by PCR using forward primer Egfp-F: CCCAAGCTTATGGTGAGCAAGGGCGAGGAG and reverse primer Egfp-R: GCTCTAGATTACTTGTACAGCTCGTCCATGC. 406 bp CMV enhancer fragment was obtained from pEGFP-N1 by PCR using forward primer hCMVen-F: 5-CGGGATCCCGCGTTACATAACTTACGGT-3′ and reverse primer hCMVen-R: 5-ACGCGTCGACCAAAACAAACTCCCATTGAC-3. Fenbendazole 1131 bp TK gene with NCBI accession number AY575228 was obtained from pMD18-TK by PCR using forward primer 5-CCGCTCGAGATGGCTTCGTACCCCTGC-3′ and reverse primer 5-CCCAAGCTTGTTAGCCTCCCCCATCTC-3. The 260 bp hTERT promoter was obtained from pMD18-T-hTERTp using forward primer hTERTp-F: 5-GGGGTACCAGTGGATTCGCGGGCACAGACG-3′ and reverse

primer hTERTp-R: 5-CCGCTCGAGAGGGCTTCCCACGTGCGCAGCA-3. All PCR fragments were verified by DNA sequence analysis. Stop codon TGA of TK gene was removed in TK reverse primer to facilitate the construction of TK-EGFP fusion protein. EGFP fragment was digested with Hind III and Xba I and subcloned into pGL3-basic plasmid to obtain pGL3-basic-EGFP. TK fragment was excised with Hind III and Xho I and subcloned into pGL3-basic-EGFP to construct pGL3-basic- TK-EGFP. hTERTp fragment was subcloned into pGL3-basic-TK-EGFP at Kpn I and Xho I sites to construct pGL3-basic-TK-hTERTp-EGFP. CMV enhancer fragment was inserted into pGL3-basic-TK-hTERTp-EGFP at BamH I and Sal I site according to previous reports [11, 12] to construct the enhanced vector pGL3-basic-hTERTp-TK- EGFP-CMV. All plasmids were verified by restriction enzyme digestion. 4.

The Viridiplantae then branched into the Chlorophyta or green algae, which include the Volvocales (e.g., Chlamydomonas this website and Volvox) and Prasinophytes (e.g., Ostreococcus and Micromonas), and the lineage that gave rise to the Spermatophyta (angiosperms, gymnosperms, bryophytes); this divergence occurred over 1 billion years ago. Genes

common to the genomes of the Chlorophyta and Spermatophyta can be traced to the Viridiplantae ancestor of these lineages; a subset of genes in this category would be involved in photosynthesis and chloroplast function. This subset could potentially be identified by comparative genomic analyses. Mining Chlamydomonas genomic sequence information A comparative analysis Small molecule library was performed in which all predicted Chlamydomonas proteins (predicted from gene models) were compared against both Arabidopsis and human protein sequences using BLAST, and the best hit scores for each Chlamydomonas protein relative to the two genomes was

shown in the analysis presented in Fig. 4 in the manuscript by Merchant et al. (2007). Some subsets of Chlamydomonas proteins were more similar to those of Arabidopsis, while others were more similar to those of humans. For example, Chlamydomonas thylakoid and stromal proteins, many of which are associated with photosynthetic function, were significantly more similar to polypeptides in Arabidopsis than to those in humans, as expected. Hence, some specific processes, including photosynthesis,

have been preserved in Chlamydomonas and Arabidopsis but not in humans (animal lineage). In contrast, genes encoding proteins associated with the structure and function of Chlamydomonas flagella have been preserved in humans and other mammals, but not in seed plants. These observations indicate that the common ancestor to Chlamydomonas and Spermatophyta was ciliated, like animal cells. However, the cilia and the genes associated with their structure and assembly were lost during the evolution of the seed plants (Merchant et al. 2007). Researchers can now integrate the power of full genome sequence analyses with the wealth of information amassed over the past several decades on photosynthetic Non-specific serine/threonine protein kinase and acclimation processes. The genomic information can be used to identify those genes present on the Chlamydomonas genome that encode proteins specifically associated with the green plant lineage; such proteins have been placed into an assemblage designated the “GreenCut” (Merchant et al. 2007; Grossman et al. 2010). Various analyses of GreenCut proteins and levels of transcripts encoding those proteins are providing new insights into their potential functions. Specific informatic tools have helped determine whether individual GreenCut proteins have a presequence that predicts their subcellular location.