Construction and identification of PC-FBG2 vector The cDNA of FBG2 gene was obtained by RT-PCR from total RNA of human gastric adenocarcinoma tissues which was used as the templet for PCR. Inner and external primers for nested PCR were synthesized respectively: S: 5′ GGGGTACCCCAGGCCATGGATGCTC 3′ 129 A: 5′ CGGGATCCAACCGGGGCAGGAGTCG 3′ 1104 (external primer)

S: 5′ GGGGTACCATGGATGCTCCCCACTC 3′ 136 A: 5′ CGGGATCCATGGACAGCTGTCAGAA 3′ 1024 (Inner primer) With the templet of total RNA from gastric adenocarcinoma tissues, nested PCR was performed to obtain the CDS double strand DNA fragments of FBG2 gene with KpnI and selleckchem BamHI restriction sites in the two ends after two cycles of reactions. KpnI and BamHI were used to incise this double strand fragments and PCDNA3.1 vector. After these incised products were purified, they were kept at 16°C over night for ligation under the actions of T4 ligase. Then the ligated products were

used to transform DH5α RSL3 in vivo competent cells, and antibiotic screening was performed. PCR identification was conducted to Barasertib select positive clones. After amplification culture, positive clones were identified by KpnI and BamHI incision. The confirmed positive clones were sent for sequencing, and eukaryon vectors PC-FBG2 with completely correct sequence of FBG2 gene were obtained. Transfection of PC-FBG2 vector in MKN45 and HFE145 cells DMEM culture medium with 10% fetal calf serum was used to culture the MKN45 and HFE145 cells in 12-well cell culture plates until the cells covered 90%–95% of the area. Serum-free DMEM was used for culture over night. Lipofectamine2000 crotamiton liposome transfection kit was used. According to the directions for use, liposome and PC-FBG2 vector DNA were mixed and added into each well. PCDNA3.1 empty vector transfection

group and blank control group (only liposome was added, and there was no vector DNA) were established. Transfection was completed after 24 hours’ incubation. Selection of cell strains with stable expression of FBG2 Transfected cells were diluted the into 24-well culture plates according to the proportion of 1:20. Then they were selected in medium containing G418. The concentration of G418 was based on the results of preliminary tests (800 μg/ml for MKN45 and 1000 μg/ml for HFE145, the concentration at which there were no surviving cells at 7 days after the time when cells covered 90% of the area of the wells in 6-well culture plate). The selection process continued for 31 days to allow colony formation. Colonies resistant to G418 were isolated with cloning cylinders and transferred into 24-well dishes. 12 and 7 positive clones were respectively obtained in the PC-FBG2 vector transfection group(MKN-FBG2) and PCDNA3.1 empty vector transfection group(MKN-PC) in MKN45 cell line.