coli, E. fergusonii and E. albertii were concatenated in the order adk, fumC, gyrB, icd, mdh, purA and recA and aligned. Based on 3,423 bp of the concatenated sequences, a neighbor-joining tree was constructed by using MEGA 4 software. Serotyping and phylogenetic grouping To characterize the CTEC strains further, their serotype and phylogenetic groups were determined

(Table 2). The 81 cattle isolates were grouped into 12 different O serogroups and 31 O:H serotypes. Two cdt-I gene-positive E. coli (CTEC-I) isolates were identified as O112ac:H20 (phylogenetic group B1) and OUT:H26 (D), respectively. Three cdt-III gene-positive E. coli (CTEC-III) isolates were identified as O2:HUT (B2), 16 as OUT (B1) and 1 OUT (D), whereas one each of the 5 CTEC-III isolates belonged to serotype O2:NM (B2), O7:H6 (B1), O88:H2 (B1), O88:H4 (B1), and O88:H6 (B1), respectively. One cdt-IV gene-positive TEW-7197 mw E. coli (CTEC-IV) AZD6094 cell line isolate was identified as O169:H10 (B2). JNK-IN-8 solubility dmso The CTEC-V isolates belonged to divergent serotypes and phylogenetic groups, including O2:H10 (B2), O8:HUT (B1), O22:H8 (B1), O22:HUT (B1), O113:H21 (B1), O113:NM (B1), O118:NM (B1), O154:H34 (B1), O156:HUT (B1), O163:HUT (B1) and OUT (30 B1 and 2 D strains), as shown in Table 2. One isolate which was positive for both cdt-III and cdt-V genes was identified as O2:HUT (B2). Five and one CTEC-V isolates from swine were identified as O98:H10 (B1) and OUT:HUT

(B1), respectively. Interestingly, the E. albertii strain Sw-9 showed cross reaction with the E. coli O84 antiserum. BCKDHA Virulence gene profile To analyze the virulence gene profile of the CTEC and E. albertii strains isolated in this study, genes for DEC, NTEC and putative adhesins reported in STEC

(see details in Material and Methods section) were investigated by colony hybridization assays (Table 2). In agreement with the previous report [20], all the CTEC-III strains possessed the cnf2 gene, indicating that cdt-III of these strains could be located on pVir-like plasmid. Surprisingly, 7 of the CTEC-V strains also possessed cnf2. The eaeA gene that encodes an outer membrane protein called intimin, which is necessary for intimate attachment of EPEC and EHEC strains to epithelial cells, was detected in the E. albertii strain Sw-9 from swine and all of the 3 CTEC-V O156:HUT (B1) strains from cattle (Table 2). The intimin subtype of three CTEC-V O156 strains was determined as θ/γ2 by PCR-RFLP, but the amplicon was not obtained in E. albertii strain Sw-9. Sixteen CTEC-V isolates (6 O22, 10 OUT) were positive for the stx1 and stx2 genes, while 6 CTEC-V strains (5 O113, 1 OUT) were positive for only stx2. Cytotoxicity assay using Vero and CHO cells, which are susceptible and unsusceptible to Stx intoxication, respectively, indicated that all the stx gene-positive CTEC strains produced functional Stx (titer ranging from 16 to 128<) and CDT (1 to 64) (Figure 3).

Of the 136 isolated S. aureus strains, 34 (25%) were resistant to oxacillin (MRSA), while none of the strains showed resistance to vancomycin (VRSA). The oxacillin-resistant strains were all isolated Apoptosis inhibitor from abscesses and Buruli ulcers. Figure 2 Staphylococcus aureus strains resistance profile to 22 antibiotics Forskolin according to their origin. Benzyl penicillin (BP), oxacillin (Ox), cefoxitin screen (Cef), gentamicin (Gen), tobramycin (Tob), kanamycin (Kan), vancomycin (Van), teicoplanin (Tei),

fusidic acid (FA), fosfomycin (Fos), rifampicin (Rif), trimethopim/sulfamethoxazole (T/Sul), erythromycin (Ery), lincomycin (Lin), pristinamycin (Pri), linezolid (Line), tetracyclin (Tet). Toxins production and/or presence of their encoding genes There was a significant difference in the production and/or the presence of genes encoding the 12 toxins (p < 0.0001). Thus, a significant number of strains (70.0%) were capable of producing PVL, followed by the production of staphylococcal enterotoxin B (SEB) (44.3%). None of the strains contained the Enzalutamide cost genes responsible for exfoliative toxin B (ETB) or staphylococcal enterotoxin D (SED) production, while the ability to produce staphylococcal enterotoxins C and E (SEC, SEE),

as well as the toxic shock syndrome toxin (TSST), was detected in <1% of strains (Figure 3). The observed difference was related to the origin of the S. aureus strains. PVL was the most commonly produced toxin, regardless

of the origin of the strains (Figure 4). PVL toxin was particularly prevalent in strains isolated Progesterone from furuncles (89.5%) and pymyositis patients (89.2%). Other toxins were produced in various proportions depending on the origin of the strain (p < 0.0001). There was a significant difference in the detection of genes encoding toxins in MRSA strains (Figure 5). Figure 3 Toxins production by the Staphylococcus aureus strains isolated from primary and secondary infections. PVL: Panton-Valentine Leukocidin; ETA: Exfoliative Toxin A; ETB: Exfoliative Toxin B; SEA: staphylococcal enterotoxin A; SEB: staphylococcal enterotoxin B; SEC: staphylococcal enterotoxin C; SED: staphylococcal enterotoxin D; SEE: staphylococcal enterotoxin E; SEG: staphylococcal enterotoxin G; SEH: staphylococcal enterotoxin H; SEI: staphylococcal enterotoxin I; TSST: Toxic-shock syndrome Toxin. Means ± standard deviations (SD) for three experiments are given. ***: p˂0.0001. Figure 4 Specificity of the toxins production by the S. aureus strains isolated from primary and secondary infections.

This interaction induced autonomous acquisition of chemoresistance. The presence of stromal cells within patient’s tumour might be predictive of chemoresistance. The specific interaction between cancer cells and stromal cells might be targeted during chemotherapy. Poster No. 89 Extracellular Matrix Regulation of EGRR Activity: Hyaluronan Alters Epidermal Growth Factor Receptor-Dependent Cell Morphology Jeanne Louderbough

1 , Joyce Schroeder1 1 Department of Molecular & Cellular Biology, University of Arizona, Tucson, AZ, USA EGFR is an important regulator of breast cancer progression and is capable of integrating multireceptor signaling pathways to promote metastasis. Through these interactions, this website EGFR is subject to extensive regulatory cues from the extracellular matrix (ECM), of which the extracellular glycoprotein hyaluronan (HA) is a major component. In mammary tumors, HA is deposited in the stromal compartment surrounding tumor epithelium where it functions in both biomechanical support and, through binding FRAX597 manufacturer to the adhesion receptor CD44, modulates intracellular

signaling. We have used a 3D collagen culture system in which HA is either polymerized into a collagen matrix to mimic epithelial-stromal interactions or provided soluble in the media (sHA). We have found that collagen-embedded HA (eHA) inhibits EGFR activation and alters cell morphology by inhibiting filopodia formation while soluble HA promotes these events. The ability of cells to spread on a collagen matrix is also impaired on eHA, demonstrating a novel function for eHA in regulating

cell morphology and membrane dynamics. Inhibition of EGFR and alterations to cell morphology are due to cell-matrix interactions, as collagen polymerization is unaltered by eHA. EGFR interaction with the HA receptor, CD44, is impaired on eHA suggesting that this is a mechanism by which HA regulates EGFR activity. Furthermore, given the ability of EGFR to alter cell morphology on a matrix, we have selleck inhibitor examined the ability of erbB ligands to regulate cell morphology on diverse matrix substrates and have found that these ligands induce collagen-dependent changes indicative of EMT. These findings highlight a novel role for eHA as a protective molecule when encountered in the collagen matrix Ureohydrolase during cancer progression, while reinforcing the tumor promoting effects of sHA, and demonstrate the ability of the ECM to alter erbB-dependent EMT. Poster No. 90 Regulation of Invadopodia Formation by Hypoxia-Induced NHE-1 Activity Fabrice Lucien 1 , Dominique Arsenault1, Claire M. Dubois1 1 Immunology Division, University of Sherbrooke, Sherbrooke, QC, Canada Most tumors are characterized by an acidic and hypoxic microenvironment that promotes metastasis. The Na+/H+ exchanger (NHE-1) plays an important role in the regulation of pH homeostasis. It has been demonstrated that NHE-1 is constitutively active in tumor cells, promoting cell invasion, but the mechanisms are not defined.

Thus, the cHtrA N-terminal

signal peptide is sufficient for directing PhoA across the bacterial inner membrane. We further found that the secretion of cHtrA was not inhibited by the C1 compound, an inhibitor known to inhibit chlamydial type III secretion system [52]. As positive controls, C1 inhibited the secretion of both IncA and CT621, two known chlamydial type III secretion substrates [30, 52]. Consistently, the secretion of CPAF was not affected by C1. This is because secretion of CPAF is dependent on type II secretion pathway selleck screening library [62]. Figure 7 cHtrA is secreted via a sec-dependent pathway. (A) The SignalP 3.0 program with both the Neural Networks (NN) and Hidden Markov Model (HMM) algorithms http://​www.​expasy.​ch was used to analyze the precursor cHtrA sequence from C. trachomatis serovar D http://​stdgen.​northwestern.​edu/​. The NN algorithm predicts a signal peptide from the first methionine residue (M1) to a serine residue at position 16 (S16) while the HMM-predicted signal peptide is M1-S23. (B) The M1-S23 peptide of cHtrA (cHtrAss) directed translocation of PhoA into bacterial periplasmic

space (cHtrAss-’PhoA, slot 1, blue). Expression of the positive control full-length PhoA construct also led to the translocation of mature PhoA (with its intrinsic signal peptide, slot 3, blue) but the negative control mature PhoA construct failed to do so (without a signal peptide, ‘PhoA, slot selleck 2, white). (C) Bacterial transformants expressing the same three constructs were fractionated into periplasmic www.selleck.co.jp/products/Gemcitabine(Gemzar).html (per) and cytosolic (cyto) fractions and the fractions were detected with antibodies against a FLAG tag (anti-Flag, panel a) and GroEL (anti-GroEL, panel b) on a Western blot. Mature PhoA was secreted into the periplasm of bacteria expressing either the full-length PhoA construct

or HtrAss-PhoA construct while mature PhoA stayed in the cytoplasm of the bacteria expressing the mature PhoA alone construct. (D) cHtrA secretion into the cytosol of chlamydia-infected cells is not inhibited by the type III secretion inhibitor C1 compound. HeLa monolayers infected with C. trachomatis L2 for 6 hr were treated with DMSO (panels a, c & e) or 50 μM C1 (b, d & f). Danusertib research buy Thirty-six hours after treatment, the cultures were processed for triply labeling with antibodies against IncA (green) and cHtrA, CT621 or CPAF (red) and DAPI for DNA (blue). C1 inhibited secretion of IncA and CT621 but not cHtrA or CPAF. Red arrows indicate chlamydia proteins that are secreted into host cell cytosol. Discussion The obligate intracellular growth of Chlamydia requires the organisms to intimately interact with host cells.

Secondly, ligating the left portal vein branch proximal to the anastomosed aortoportal shunt results in a portal pressure increased from 6.22 mmHg to 8.55 mmHg (p < 0.05) however, the flow per gram liver in these portally perfused (not shunted) segments remained unchanged (1.57 to 1.53 mL/gram/minute, not significant) whereas the flow in the shunted segments increased significantly

from an average of 0.61 to 2.89 mL/gram/minute after shunt opening giving a 4.75 fold increase in flow which is similar to the flow increase seen after a 75% PHx [21]. Thus, it may be that it is not the quantity of blood perfusing the liver sinusoids in the remnant which is detrimental to liver regeneration, but rather Saracatinib clinical trial the quality of the blood (with hepatotrophic BIBF 1120 in vitro factors) as previously suggested by Michalopoulos [47]. Supportive of this theory is the findings of Ladurner et al. where extended hepatic resection with or without decompressive portocaval shunting (and thus significant differences in flow in the liver remnant) did not reveal differences in liver regeneration [48]. Conceivably equally important,

are the increased metabolic tasks per gram remaining liver imposed on the liver remnant which may lead to its growth. We CSF-1R inhibitor maintain, on the basis of this experiment, that the flow theory of increased shear stress as a primary stimulus to liver regeneration is questionable because it is the non-shunted, portally perfused side which hypertrophies despite the fact that flow per gram liver

on this side remains unchanged. In contrast to this, the shunted segments exhibited contracted Interleukin-3 receptor lobuli, no increase in volume and a general downregulation in transcriptional activity. We suggest that the portally perfused side of the liver hypertrophied due to a combination of increased metabolic demand (due to the functional deficiency of the shunted side) and the presence of hepatotrophic growth factors in the portal perfusate. Finally, is it justifiable to study the process of liver regeneration without performing a resection? In our opinion, yes, because the moment one performs a liver resection, the relative increase in growth factors supplied, and the increase in metabolic demand on the liver remnant confounds the study of an isolated increase in flow per gram remaining liver parenchyma. It is therefore necessary to create an “”unphysiological “”state to study an isolated phenomenon in vivo. Conclusions On the basis of the present study we conclude that an isolated acute and chronic increase in sinusoidal flow does not have the same genetic, microscopic or macroscopic impact on the liver as that seen in the liver remnant after partial hepatectomy, indicating that increased sinusoidal flow may not be a sufficient stimulus in itself for the initiation of liver regeneration.

Am J Physiol 1993, 265:C577-C606.PubMed 25. Bisaggio DFR, Peres-Sampaio CE, Meyer-Fernandes JR, Souto-Padron T: Ecto-ATPase activity on the surface of Trypanosoma cruzi and its possible role

in the parasite-host cell interaction. Parasitol Res 2003, 91:273–282.PubMedCrossRef 26. Kansas GS, Wood GS, Tedder TF: Expression, Distribution, and Biochemistry of Human Cd39 – Role in Activation-Associated Homotypic Adhesion of Lymphocytes. J Immunol 1991, 146:2235–2244.PubMed 27. Biemans-Oldehinkel E, Doeven MK, Poolman B: ABC transporter architecture and regulatory roles of accessory domains. FEBS Lett 2006, 580:1023–1035.PubMedCrossRef 28. Stollenwerk M, Fallgren C, Lundberg F, Tegenfeldt JO, Montelius L, Ljungh A: Quantitation of bacterial adhesion to Copanlisib cost polymer surfaces by bioluminescence. Zentralbl Bakteriol 1998, 287:7–18.PubMed 29. Bredt W, Feldner J, Klaus B: Adherence of Mycoplasmas – Phenomena and Possible Role in the Pathogenesis of Disease. Infection 1982, 10:199–202.PubMedCrossRef 30. Leipe DD, Koonin EV, Aravind L: Evolution and classification of P-loop kinases and related proteins. J Mol Biol 2003, 333:781–815.PubMedCrossRef 31. Shimizu TKYKK: Cytoadherence-dependent induction of inflammatoryresponses by Mycoplasma pneumoniae. Immunol 2011, 133:51–61.CrossRef 32. Bours MJL, Swennen ELR, Di Virgilio F, Cronstein BN, Dagnelie PC: Adenosine 5′-triphosphate selleck inhibitor and adenosine as endogenous signaling molecules in immunity and inflammation.

Pharmacol Ther 2006, 112:358–404.PubMedCrossRef 33. Zhang SM, Lo SC: Effect of mycoplasmas on apoptosis of 32D cells is species- dependent. Curr Microbiol 2007, 54:388–395.PubMedCrossRef 34. Coutinho-Silva R, Correa G, Sater AA, Ojcius DM: Niclosamide The P2X(7) receptor and intracellular pathogens: a continuing struggle. Purinergic Signal 2009, 5:197–204.PubMedCrossRef 35. Lammas DA, Stober C, Harvey CJ, Kendrick N, Panchalingam S, Kumararatne DS: ATP- induced killing of mycobacteria by human macrophages is mediated by purinergic P2Z(P2X(7)) receptors. Immunity 1997, 7:433–444.PubMedCrossRef

36. Molloy A, Laochumroonvorapong P, Kaplan G: Apoptosis, But Not Necrosis, of Infected Monocytes Is Coupled with Killing of Intracellular Bacillus-Calmette-Guerin. J Exp Med 1994, 180:1499–1509.PubMedCrossRef 37. Taylor-Robinson D, Davies HA, Sarathchandra P, Furr PM: Intracellular locationof mycoplasmas in cultured cells demonstrated by immunocytochemistry and electronmicroscopy. Int J Exp Pathol 1991, 72:705–714.PubMed 38. van der Schee C, Sluiters HJ, van der Meijden WI, van Beek P, Peerbooms P, Verbrugh H, van Belkum A: Host and pathogen this website interaction during vaginal infection by Trichomonas vaginalis and Mycoplasma hominis or Ureaplasma urealyticum. J Microbiol Methods 2001, 45:61–67.PubMedCrossRef 39. Diaz-Garcia FJ, Herrera-Mendoza AP, Giono-Cerezo S, Guerra-Infante FM: Mycoplasma hominis attaches to and locates intracellularly in human spermatozoa. Hum Reprod 2006, 21:1591–1598.PubMedCrossRef 40.

Then PCR was performed for 30 cycles at 95°C, 30 s; 55°C, 30 s; 72°C, 30 s with a final amplification for 5 min at 72°C. The IL-8 gene was amplified using the primers IL-8 Forward GTTCCACTGTGCCTTGGTTT and IL-8 Reverse ACACAGCTGGCAATGACAAG, and the β-actin

gene as control was amplified using β-actin Forward AAATCTGGCACCACACCTTC and A-1210477 cost β-actin Reverse AGTGGGGTGGCTTTTAGGAT. Visualisation of the PCR products was performed following agarose gel electrophoresis using SYBRsafe (Invitrogen) and a UV light source on a G:Box from SynGene and using the software GeneSnap from Syngene. Quantification was performed by comparing the intensity of the PCR product bands to the click here Quantitative Hyperladder I (Bioline) as a reference and then determining the ratio between IL-8 and β-actin PCR products in each sample. Statistical analysis Significance of the differences between groups was assessed using one way analysis of variance (ANOVA) with post-hoc Tukey-Kramer multiple comparisons test using GraphPad Instat software. p < 0.05 were considered statistically significant. Acknowledgements We thank Prof Takeshi Honda (Osaka University, Japan) for providing V. parahaemolyticus RIMD2210633, Dr Dominique Schneider GSK621 datasheet for providing plasmid

pDS132 (Université Joseph Fourier, France) and Dr Eric Stabb (University of Georgia at Athens, USA) for providing E. coli CC118λpir(pEVS104). We thank Ann Smyth and Niamh McCormack Org 27569 for assistance in construction of mutants and Stephen Cunningham for assistance with the MDC assay. KMW and AM were funded by Marie Curie Transfer of Knowledge “”GAMIDI”" EU Transfer of Knowledge grant # MTKD-CT-2005-029774 and RF was funded by Science Foundation Ireland Research Frontiers Programme grant # 08-RFP-BIC1243. Some of the early studies for this work were funded by the National University of Ireland, Galway’s Millennium Fund. Electronic supplementary material Additional file 1: Figure S1: Morphological changes induced in Caco-2 cells by V. parahaemolyticus Δ vp1680. Caco-2 cells were co-incubated

with V. parahaemolyticus WT, ΔvscN1, ΔvscN2 or Δvp1680 for 4 h. Morphological changes of the cells were then observed by phase contrast light microscope (magnification 400×). (PDF 948 KB) References 1. Krantz GE, Colwell RR, Lovelace E: Vibrio parahaemolyticus from the blue crab Callinectes sapidus in Chesapeake Bay. Science 1969,164(885):1286–1287.PubMedCrossRef 2. Kaneko T, Colwell RR: Ecology of Vibrio parahaemolyticus in Chesapeake Bay. J Bacteriol 1973,113(1):24–32.PubMed 3. Nair GB, Ramamurthy T, Bhattacharya SK, Dutta B, Takeda Y, Sack DA: Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants. Clin Microbiol Rev 2007,20(1):39–48.PubMedCrossRef 4. Boyd EF, Cohen AL, Naughton LM, Ussery DW, Binnewies TT, Stine OC, Parent MA: Molecular analysis of the emergence of pandemic Vibrio parahaemolyticus .

​com, PPP http://​bioinformatics.​biol.​rug.​nl/​websoftware, PROMSCAN [35] or Promoter Prediction by Neural Network [36]; (iii) prediction of terminators with TransTermHP [37]; and (iv) search for homologs across different phage types within our data

set and in the non-redundant database at NCBI. Phage gene expression analysis using RNAseq RNA from three biological replicates of B. pseudomallei DD503 (a derivative of 1026b) grown in LB was extracted from cells in early logarithmic growth using RNAeasy (QIAgen, Valencia CA). Ribosomal RNAs were removed by 2 rounds of MicrobExpress (Ambion, Foster City CA). Each RNA preparation was used in individual cDNA synthesis reactions using SuperScript II (Invitrogen, Carlsbad CA) and sequenced individually in the Illumina Genome Analyzer (Illumina Technologies, San Diego CA) or SOLiD instruments with 100 or 50 bp reads, respectively. Data was analyzed using CLC Genomics Workbench allowing for 2 mismatches Idasanutlin in vitro in each read and only one

map location per read. Total gene expression was normalized according to the total number of reads in the library and the gene size, resulting in reads per kilobase per million reads (RPKM). Only genes that had more than 10 hits were considered to be expressed above the noise level. Results and Discussion Isolated and sequenced bacteriophages Five bacteriophages were isolated from three B. pseudomallei and two B. thailandensis strains (Table 1A) when plaqued on B. mallei ATCC 23344 as a suitable host for bacteriophages [3, 6, 21]. Most B. pseudomallei and B. thailandensis SAHA order strains only produced one phage, except for E12 and 644 which each produced at least two different phage particles. All of the bacteriophages contained long tails. Three were classified as P2-like viruses, one as a lambda-like virus, and one as a Mu-like virus. The bacteriophage genomes ranged in size from 35.7 to 48.7 Kb and contained from 47 to 71 genes. Specific details about each of these bacteriophages are provided below, representative images

of each Montelukast Sodium isolated bacteriphage are shown in Fig. 1A and other properties are described in Table 1A. Figure 1 Transmission electron micrographs (TEM) of the Burkholderia bacteriophages analyzed in this project and see more Schematic illustrations of their genomes. (A) TEM of bacteriophages negatively stained with 1% phosphotungstic acid. (B) Schematic illustrations of the P2-like Myoviridae genomes of ϕ52237, ϕE202, and ϕE12-2. Cyan shading represents sequences that are conserved in the subgroup A Myoviridae ϕ52237, ϕE202, and ϕK96243 and lime shading represents sequences that are conserved in the subgroup B Myoviridae ϕE12-2, GI15, and PI-E264-2. Gray shading represents sequences that are variably present in Myoviridae subgroups A and B. (C) Schematic illustration of the lambda-like Siphoviridae genome of ϕ644-2. Gray shading represents sequences that are unique to ϕ644-2. (D) Schematic illustration of the Mu-like Myoviridae genome of ϕE255.

The supernatant was then decanted, replaced with fresh media and 1 ml of this culture was used to inoculate the MFC. For the co-culture experiments selleck chemical the method was the same as the pure culture with 500 μl of each culture being added to the reactor. Microbial fuel cells and electrochemical measurements Plate type reactors were constructed as described in Aelterman et al., [31] with an anode volume of 336 cm3. The modification to this reactor design as used in this study was the addition of removable side panels for sample collection and only two cathode and anode compartments. A cation exchange

membrane (Ultrex CMI-7000, Membranes International, USA) was placed between the anode and cathode compartments and rubber seals were used to securely seal the compartments. Granular graphite with diameter ranging between 2 and

6 mm (El Carb 100, Graphite Sales, Inc., USA) was used in the cathode compartment as an electrode with a graphite rod through each compartment used for external connection. The granules were initially left overnight in 1 M HCl, washed with deionized water, left overnight again in 1 M NaOH and then washed several times in deionized water. The total empty volume of the cathode compartment was 336 cm3 and approximately 182 cm3 when the granules were added. The anode electrode had the same type of graphite rod, which connected to twelve 2 cm × 1 cm × 1 cm graphite blocks, one 10 cm × 2 cm × 1 cm and one 10 cm × 1 cm × BIBF 1120 supplier 1 cm graphite blocks to make up the total electrode surface area of 72 cm2 used for sampling. These blocks were initially lightly smoothed with fine grade wet/dry sandpaper, washed and autoclaved. The electrode arrangement is shown in Figure 1. The voltage over the MFCs was monitored using an Agilent 34970A data acquisition unit. A full channel scan was performed every 30 s and data was stored. External resistance was 100, all calculations were performed according to Rabaey et al., [37] and Logan et al., [38]. MFC Reactor operation Initially, a series Dimethyl sulfoxide of MFC batch experiments was performed in triplicate for each bacterial strain in the presence

(closed circuit) and absence (open circuit) of external current. These batch reactors used recirculated media and were ICG-001 operated for three days. This time point was chosen as during optimization of the experiments, the highest current peak was achieved during this time. MFCs were sterilized by flushing with household bleach (50% with MiliQ water) over night and then recirculated with sterile MilliQ for two days, to ensure all residual bleach was removed, followed by UV irradiation. Anodes and cathodes of the reactors were flushed prior to the experiment with nitrogen gas to create anaerobic conditions. Then the anode was filled with anaerobic autoclaved media, with no soluble electron acceptor for the closed circuit experiments, while the cathode was filled with anaerobic catholyte.

A variety of marine hydrocarbon SBI-0206965 concentration degrading prokaryotes has been described, mainly from the Alpha-, and Gammaproteobacteria[20, 21]. One example is the genus Alcanivorax of the Gammaproteobacteria, regarded as a main player in aliphatic hydrocarbon degradation in marine environments [20].

Other genera like Maricaulis and Roseovarius (Alphaproteobacteria) and Marinobacter (Gammaproteobacteria) are capable of using polycyclic aromatic hydrocarbons (PAHs) as carbon sources [22]. Although prokaryotic communities related to active seepage sites are well studied (e.g. hydrocarbon seeps in the Timor Sea [23], an asphalt volcano in the Gulf of Mexico [24] and Coal Oil Point seep sediments [9]), less is known about the prokaryotic communities in sediments influenced by low level flux (seepage) from underlying hydrocarbon reservoirs over geological time. In this study we have combined analyses of high throughput (454 GS FLX Titanium) sequenced metagenomes with geochemical data to characterize prokaryotic communities in surface sediments from the Troll area. The aim was to characterize the taxonomic distribution and metabolic potential of the communities, both in general and related to possible hydrocarbon degradation. Further, we wanted

to find whether there was an increased potential for methane oxidation or see more other microbial processes that might support the idea of seepage in the pockmark sediments, or if analyses of the prokaryotic communities would agree with the geological analyses indicating no active hydrocarbon seepage from the pockmarks at the present time [15]. We therefore analyzed LDN-193189 mouse sediment samples both from four pockmark samples and one sample from the Troll plain. As references regarding thermogenic hydrocarbon influence, we chose two sediment samples from the seabed in the outer part of the Oslofjord (south

of Drøbak, Norway). This area is characterized Tideglusib by Precambrian bedrock, formed more than 542 million years ago, and the presence of thermogenic hydrocarbons is therefore unlikely [18]. Results The sediment samples from the Troll area were taken from pockmarks (Tpm1-1, Tpm1-2, Tpm2 and Tpm3) as well as one sample from the Troll plain (Tplain) (Figure 1). Sample Tpm1-1 and Tpm1-2 were taken from the same pockmark (named pm1), while samples Tpm2 and Tpm3 were taken from two smaller pockmarks (named pm2 and pm3, respectively). The two Oslofjord samples (OF1 and OF2) were taken from the outer part of the fjord (Additional file 1: Figure S1). Chemical analyses of the sediment porewater, as well as total organic carbon (TOC) and hydrocarbons in the sediments have revealed differences in available carbon and nitrogen sources in the two areas (Table 1 and Additional file 2: Table S1) [25].