MICs are determined from the molecular assays as the culture with the lowest concentration of drug that produces this website a difference in Ct value that remains less than 3.33 cycles between its Ct value and the Ct value of the culture with the highest concentration

of drug, where growth is fully inhibited. Four discrepancies are noted: aAt 4 hours, the MIC value of the gsPCR method of MRSA versus oxacillin could not be determined since the difference in Ct values moved above and below the cut-off value between several concentrations. bAt 4 hours, the MIC value of <0.25 μg/mL from the ETGA method of MRSA harvested from blood culture versus vancomycin is interpreted as susceptible and is in agreement with the macrobroth method. However, the 16 μg/mL culture from the AST series produced a Ct value that indicates resistance. cAt 6 hours, the MIC value of the gsPCR method of MRSA harvested from blood culture versus oxacilin is interpreted as susceptible, while the macrobroth method MIC is

interpreted as resistant. This is defined as a very major error (VME). dThe gsPCR results from the MRSA harvested from blood culture versus vancomycin produced several reactions with negative results. The baseline was arbitrarily adjusted to account for the lack of signal for these reactions. All discrepancies are discussed in the text. Results Molecular AST time course analysis of bacteria from purified cultures Methicillin sensitive S. aureus strain ATCC 29213 and E. coli strain ATCC 25922 are both quality control strains for the macrobroth EPZ015666 nmr method and estimated MICs for these organisms for the antibiotics tested against them are indicated by the CLSI protocols and standards [6]. The ranges of SBI-0206965 mw antibiotic concentrations that were tested are based upon these published values. Methicillin resistant S. aureus strain NRS241 has MICs against specific drugs published on the NARSA website (http://​www.​narsa.​net)

and the concentration range tested was based upon these values. The time course curves for both the ETGA and gsPCR molecular analysis is shown in Figures 2, 3 and 4 and compared to the visual end-point analysis of before the macrobroth dilution method. The data sets containing the measured Ct values can be found in Additional file 1: Table S1. The ETGA time course analysis for each antibiotic/microorganism combination tested demonstrate that in growth control cultures which contain no drug the ETGA signal increases robustly over time. Depending on the combination tested, however, the rate of change in signal depends on the amount of antibiotic present. For instance, the MSSA versus oxacillin combination (Figure 2B) shows that there is an increase in signal in the early time points out to 2 μg/mL, but the 22 hour time point only the 0 and 0.125 μg/mL cultures demonstrate a continuous increase in signal. At 22 hours, the curves actually indicate a decrease in signal from 0.25 to 8 μg/mL.

The yeast cells were grown in YPD (1% yeast extract, 2% peptone and 2% dextrose), YPGAL (1% yeast extract, 2% peptone and 2% galactose) or complete synthetic medium (0.17% yeast

nitrogen base (YNB), 0.5% ammonium sulfate, all required amino acids plus 2% glucose). SD = synthetic dextrose medium. For most analyses, when yeast strains were grown on glucose or galactose, the cells were harvested by centrifugation at stationary phase, which corresponds to an OD600 nm between 2.0 and 5.0. Viability assays: The tolerance of yeast cells to H2O2 or to t-BOOH was determined by the spot test, Bafilomycin A1 as described below. Inoculates were obtained from cells that were grown overnight in YPD or complete synthetic media with 2%

glucose (indicated in the figures). Combretastatin A4 Inoculates were diluted to OD600 nm = 0.2, and yeasts were grown until cell density reached stationary phase (around 16 h). Finally, the cell cultures were diluted again to OD600 nm = 0.2, and then four subsequent 1:5 dilutions of these cell suspensions were performed. A 5 μL droplet of each dilution was plated onto YPD or complete synthetic medium (SD) plus agar with the stress agent. Peroxides were added to plates at the concentrations indicated in the figures. DTT or tunicamycin was spread onto the plates just before use. To test cell viability under 4-Aminobutyrate aminotransferase heat shock conditions, the strains were grown until cell density reached OD600 nm = 0.8, and they were divided into two aliquots, which were incubated at 30°C (control) or 37°C. The serial dilutions (starting from OD600 nm = 0.2) were spotted onto YPD agar plates, and the plates were incubated for 48 h at 30°C. Construction of yeast overexpression vector pYES-TOPO + POF1: The coding region of POF1 gene was cloned from

yeast genomic DNA using the following specific MRT67307 primers: POF1 forward 5′TGCTGTCACATATGAAGAAGAC and POF1 reverse 5′TAAACGGATCCTCAATCAAATATTG, which contain NdeI or BamHI restriction enzyme sites adaptors, respectively (underlined sequences). This PCR-isolated DNA fragment was purified with the GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Uppsala, Sweden) and ligated into the pYES-TOPO backbone to form pYES-TOPO + POF1 for yeast expression (controlled by GAL1 promoter) and into the pET15b vector to generate pET15b + POF1 for bacterial expression (controlled by T7 promoter). The POF1 gene was added to pYES2.1-TOPO TA (Invitrogen) reaction media according to the manufacturer. The ligation product was transformed into Escherichia coli DH5α bacteria strain by electroporation. The transformed clones were grown in LB + ampicillin (100 μg/mL), and the plasmids were isolated with the Illustra plasmidPrep Mini Spin Kit (GE Healthcare).

Fungal Divers. doi:doi:​10.​1007/​s13225-012-0174-9 Jiang XZ, Yu HY, Xiang MC, Liu XY, Liu XZ selleck screening library (2011) Echinochlamydosporium variabile, a new genus and species of Zygomycota from soil nematodes. Fungal Divers 46:43–51CrossRef Núñez M, Ryvarden L (2001) East Asian polypores 2. Polyporaceae s. lato. Synop Fungorum 14:165–522 Nylander JAA (2004) MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University Petersen JH (1996) Farvekort. The Danish Mycological Society’s color-chart. Foreningen til Svampekundskabens Fremme, Greve Pilát A (1953) Hymenomycetes novi vel minus cogniti Cechoslovakiae II. Acta

Musei Nationalis Pragae 2:1–109 Pinruan U, Rungjindamai N, Choeyklin R, Lumyong S, Hyde KD, Jones EBG (2010) Occurrence and diversity of basidiomycetous endophytes from the oil palm, Elaeis guineensis in Thailand. Fungal Divers 41:71–88CrossRef Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. CHIR98014 price Bioinformatics 14:817–818PubMedCrossRef Reid DA (1973) A reappraisal of type and authentic specimens of Basidiomycetes in the van der Byl herbarium, Stellenbosch. S Afr J Bot 39:141–178 Robledo GL, Amalfi M, Castillo selleck chemical G, Rajchenberg M, Decock C (2009) Perenniporiella chaquenia sp. nov. and further notes on Perenniporiella and its relationships with Perenniporia

(Poriales, Basidiomycota). Mycologia 101:657–673PubMedCrossRef Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574PubMedCrossRef Ryvarden L (1972) Studies on the Aphyllophorales of the Canary Islands with a note on the genus Perenniporia. Nord J Bot 19:139–144 Ryvarden L (1991) Genera of Polypores. Nomenclature and taxonomy. Fungiflora, Oslo Ryvarden L, Gilbertson RL (1994) European polypores 2. Synop Fungorum 7:394–743 Ryvarden L, Johansen I (1980) A preliminary Polypore Flora of East Africa. Fungiflora 1980, Oslo Swofford find more DL (2002) PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version 4.0b10. Sinauer Associates, Sunderland,

Massachusetts Teixeira AR (1993) Chave para identificação dos gêneros de Polyporaceae com base na morfologia do basidiocarpo. Boletim do Instituto de Botânica 8:1–55 Thomson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The Clustal_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882CrossRef Wang W, Yuan TQ, Wang K, Cui BK, Dai YC (2012) Combination of biological pretreatment with liquid hot water pretreatment to enhance enzymatic hydrolysis of Populus tomentosa. Bioresource Technol 107:282–286CrossRef White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Protocols: a guide to methods and applications.

These cultures were incubated at

30°C with vigorous shaking, and at time 0, 36 and 54 hrs, 1 ml culture was centrifuged. The supernatant was used for HPLC with an Elite LaChrom system (Hitachi). The samples were filtered with PALL Life Science Acrodisc 13 mm syringe filters with 0.2 μm nylon membranes, and analyzed with 5 mM H2S04 mobile phase filtered with Gelman Sciences Nylaflo 47 mm 0.45 μm nylon membrane filter paper, degassed and at 0.5 mL/min flowrate for 35 mins with Biorad -Aminex HPX-87H column (300 × 7.8). The column temperature was maintained at 60°C, and the RI detector maintained STA-9090 in vitro at 50°C. RNA isolation and Reverse Transcription-PCR Total cellular RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. RNA samples were treated

with RNase-free DNase I (Ambion) to digest residual chromosomal DNA and purified with RNeasy Kit (Qiagen) prior to spectrophotometric quantification at 260 nm. For RT-PCR, 0.1 μg RNA template was used in a Superscript One-step RT-PCR kit (Invitrogen) as recommended by the manufacturer. The Belinostat cost Primers used were ryhB-F2 and R2, control 1-6 F and R high throughput screening compounds (Table 2). 5′- and 3′-RACE assays RACE (rapid amplification of cDNA ends) experiments were carried out essentially as described [19]. For 5′ RACE, the 5′-triphosphates of 15 μg total RNAs were converted to monophosphates by 25 units of tobacco acid pyrophosphatase (Epicentre Technologies) at 37°C for 1 hr, followed by phenol/chloroform extraction and ethanol precipitation. Precipitated RNA was resuspended in water and ligated to 500 pmol 5′- RNA adapter (Table 2). The ligated product was purified by phenol/chloroform extraction and ethanol precipitation, and reverse transcribed with 2 pmol sRNA-specific primer RyhB-R3 using the Thermoscript RT system (Invitrogen). The product was amplified by PCR, cloned into a pCR2.1 TOPO vector (Invitrogen)

and sequenced. 3′-RACE assays were performed similarly to 5′-RACE, except that total RNA was dephosphorylated by calf intestine alkaline phosphatase (New England Resminostat Biolabs), ligated to a 3′-RNA adapter (Table 2) and reverse transcribed with 100 pmol of a single primer complementary to the 3′-RNA adapter. Quantitative RT-PCR The cDNA template for RT-PCR was synthesized in a 10 μl final reaction volume containing 3 μg of total RNA, 3 μg random primers (Invitrogen), 0.5 μM dNTPs, 10 mM DTT, 1 × first-strand buffer and 100 U of Superscript II reverse transcriptase (Invitrogen). After incubation at 42°C for 2 hours, the reaction was diluted five fold in H2O and stored at -80°C. Quantitative RT-PCR was carried out in an iCycler thermal cycler (Bio-Rad) in a 30 μl reaction mixture containing 15 μl iQ SYBR supermix (Molecular Probes), 1 μl cDNA template, and 160 nM forward and reverse primers. Primers were designed using the program Omiga 2.0 (Oxford Molecular) to yield a PCR product of ~100 bp in length (Table 2).

In the last cycle, the elongation step was extended to 10 minutes. PCR product (300 bp) was separated in 2% agarose gel. Oxidant/antioxidant status of liver tissue

Accurately weighed pieces of liver tissue were treated differently to study the oxidant/antioxidant status of the liver. Two portions were used to prepare 10% homogenate in 1.15% KCl and 5% homogenate in 3% sulfosalicylic acid, centrifuged at 1000 ×g at 4°C for 20 minutes. Resulted supernatants were used for the assay of malondialdehyde (MDA) as described by Yoshioka et al. [20] and glutathione (GSH) according to Srivastava and YM155 Beutler [21] levels, respectively. Portion of the liver was homogenized in Tris-sucrose buffer pH 7.4 (10% homogenate) and centrifuged at 15,000 ×g, at 4°C for 30 minutes, using Dupont-Sorvall Ultracentrifuge (USA), to isolate the cytosolic fraction. Cytosolic fraction

was used for glutathione peroxidase (GPX) assay as described by Arthur and Boyne [22] and glutathione reductase (GR) according EVP4593 to Long and Carson [23]. Protein concentration of the above supernatant was estimated by the method of Lowry et al. [24]. Histopathological examination of liver sections of the different groups Slices of liver tissue were fixed in formal-saline, dehydrated in alcohol series and embedded in paraffin wax. Serial sections were made from each paraffin block, stained by eosin and hematoxlin dyes, and then submitted to histopathological examination under light microscope (Olympus Optical Corp., Tokyo, Japan). Statistical analyses RAPD-PCR banding patterns of the liver samples were scored for the presence (1) or for selleck products absence (0) of each amplified band. All RAPD assays were repeated thrice and only the reproducible bands were scored. For considering a marker as polymorphic, the absence of an amplified product in at least one sample was used as a criterion. For genetic distance analysis, data sets were fed into the clustering program of SPSS (Version 14.0) and similarity matrix PtdIns(3,4)P2 was determined using Jaccard’s coefficient. Next, distance matrix (distance = 1 – similarity) was calculated. Based on similarity

matrices using the unweighted pair group method analysis, STATISTICA program for Windows, 1995 (StatSoft, Inc., USA) was used to generate UPGMA dendrogram [25]. The Chi-square test was used to analyze the data obtained. Results of oxidant/antioxidant status were analyzed using one way analysis of variance (ANOVA) followed by Kruskal-Wallis test using SPSS software (Ver. 14.0). Differences were considered statistically significant if P < 0.05. Results RAPD analysis RAPD analysis of liver samples was carried out using four different primers. The results revealed that approximately 37 different banding patterns were obtained. Amplification with EZ primer generated 3 monomorphic bands and 6 polymorphic bands in a total of 9-banded RAPD patterns (Fig. 1).

8 and 11 nm only. As a result, the photoexcited holes are readily thermionically excited out of the wells and swept out of the intrinsic AZD8931 order region under the influence of the external and built-in electric field as we have

reported elsewhere [31]. This is a very fast process AZD2171 mouse and would give a fast component to the PC transients. The main contribution to the steady state PC is therefore due to the electrons. In order for an electron photogenerated in the QW to contribute to the photocurrent, it must either be thermionically excited or tunnel into the continuum over the CB discontinuity or sequentially tunnel into the neighbouring wells [23, 32]. Which of these two processes dominates PC should depend upon the temperature, barrier height/thickness and the applied bias. Under optical illumination, electron–hole pairs are generated in the quantum wells. The disparity between the electron and hole escape rates from the QWs means that even a small electric field across a well will allow the holes to escape. Instead, because of the different confinement energy, the electrons are trapped in the well, and without holes in the valence band, they cannot recombine and start accumulating. This electron accumulation acts as a space charge, screening

the built-in charge of the junction. Consequently, the applied voltage is not uniformly distributed across the intrinsic region; instead, it will be click here applied only between the positive charge at the edge of the n-type region and the closest well with a large negative charge. High-field domain [22] is formed, and an increase in the applied bias leads to the reduction of the electron escape time for a single well at a time. Further increase of the electric field

makes the O-methylated flavonoid high-field domain high enough to allow electrons to escape and flow the n-type region resulting in a sudden change (an oscillation) in PC. PC oscillations are visible also in superlattice structures [24], but they are based to the strong carrier coupling among the wells, leading to the occurrence of negative differential resistance (NDR) via sequential resonant tunnelling between adjacent QWs. However, because of the thick GaAs barriers between adjacent QWs in our structures, sequential resonant tunnelling is unlikely to occur. Hence, we did not observe any NDR. Thermionic emission from the QWs and Fowler-Nordheim [33] tunnelling from the well adjacent to the n-type bulk region are instead the two likely electron escape mechanisms. The hole capture time by the QWs is much longer than the hole flight time between adjacent wells so that the holes transfer rapidly to the p-region of the device without being captured [31]. This results in the net negative charge accumulation in the wells. PC oscillations do not occur in samples with a strong hole confinement, i.e. in samples with high In concentration as implied by Chen et al. [34] where the indium concentration was 35% and the nitrogen 0.23%, with ΔE C = 510 meV and ΔE V = 130 meV.

8 eV were identified, which were attributed to carbon group (C = C/C-C, CH x ), hydroxyl groups or ethers (−C-OR), carbonyl or quinone groups (>C = O), and carboxylic groups, esters, or lactones (−COOR), respectively. These results also reveal the presence of organic functional groups selleck chemicals on the surface of the nanorods, in good agreement with the FTIR results. Selleck GSK690693 Figure 5 XPS survey spectrum of the as-prepared MnO nanorods. The inset shows the C 1s core-level spectrum and the peak fitting of the C 1s envelope. The porous characteristic

of the as-synthesized MnO nanorods was examined by nitrogen adsorption isotherm measurements. The specific surface area and pore size distribution (PSD) of the MnO nanorods were obtained from an analysis this website of the desorption branch of the isotherms using the density function theory. As shown in Figure 6, an isotherm is typical for a mesoporous material with a hysteresis loop at high partial pressures. According to the Brunauer-Emmett-Teller analysis, the as-synthesized MnO nanorods exhibited large specific surface area of ca. 153 m2 g−1 and pore volume of ca. 0.22 cm3 g−1. The inset in Figure 6 shows the Barrett-Joyner-Halenda PSD curve that was centered at ca. 3.9 nm, suggesting that the MnO nanorods possess uniform mesoporous structures. Figure 6 N 2 adsorption-desorption isotherms and pore size distribution curve

of the MnO nanorods. To investigate the formation mechanism of the MnO nanorods, a series of time-dependent experiments were carried out. As shown in Figure 7a, numerous amorphous manganese

precursor NPs with size of ca. 5 to 6 nm were observed when the reaction was executed for 1 h. Figure 7b shows that larger NPs with size of ca. 20 to 30 nm were formed when the reaction time was increased to 3 h. The inset in Figure 7b reveals that the lattice fringe is ca. 0.36 nm, consistent with the d 012 spacing for rhodochrosite MnCO3, indicating that the transformation from manganese precursor to MnCO3 happened in the earlier stage. When the reaction time was increased to 6 h, many nanorod-like particles could be obtained besides dispersed NPs (Figure 7c). It can also be seen that the nanorod-like products were formed by the self-assembly of small NPs. Figure 7d shows Demeclocycline an HRTEM image taken from two adjacent NPs. The lattice fringes were found to be ca. 0.36 and 0.26 nm, corresponding to the d 102 spacing for rhodochrosite MnCO3 and the d 111 spacing for cubic MnO, respectively, suggesting that the transformation from MnCO3 to cubic MnO was incomplete within a short time. When the reaction time was further increased to 12 h, a large number of nanorods were formed (Figure 7e). Figure 7f shows an HRTEM image of one nanorod aggregated by small nanocrystals, and the boundary can be observed among the NPs. The SAED pattern in the inset of Figure 7f presents a polycrystalline character of the nanorods, indicating that the nanorod is of an ordered assembly of nanocrystals without crystallographic orientation.

Relative abundance indexes (values 1 and 2), changes in protein expression ratios (value 3), and associated V diff values (value 4) indicating confidence levels of changes in expression ratios for enzymes involved in (A) conversion of phosphoenolpyruvate to pyruvate (B) catabolism of pyruvate into end-products, and (C) electron transfer pathways between ferredoxin (Fd), NAD-(P)H, and H2. PEP, phosphoenol pyruvate; OAA, oxaloacetate; Fd, ferredoxin. Pyruvate Catabolism and end-product synthesis Synthesis of organic end-products from pyruvate is mediated by enzymes comprising two major branchpoints, namely the pyruvate/acetyl-CoA/lactate branchpoint and

the acetyl-CoA/ethanol/acetate branchpoint, while H2 can be generated from reduced ferredoxin selleck inhibitor (Fdr), NADH, or NADPH using multiple hydrogenase

(H2ase) complexes (Figure  3). While the functionality of these pathways has been verified using enzyme assays [4, 55], and transcriptional expression of the genes involved in these pathways has recently been elucidated [22, 36, 37], there have been no reports regarding the expression levels of these genes at the protein level. Given that click here there are apparent redundancies in genes encoding enzymes with analogous functions (e.g. pyruvate:ferredoxin oxidoreductases, alcohol dehydrogenases, hydrogenases) according to the current annotation, it is important that protein abundances and their expression profiles under physiological conditions be determined for the effective application of metabolic engineering strategies to improve rates and/or yields of H2, ethanol, and other desired end-products. Pyruvate/acetyl-CoA/lactate branchpoint C. thermocellum may convert pyruvate into (i) CO2, Fdr, and acetyl-CoA, (ii) formate and acetyl-CoA, and (iii) lactate Urease via pyruvate:ferredoxin oxidoreductase (POR), pyruvate:formate lyase (PFL), and lactate deATM signaling pathway hydrogenase (LDH), respectively [4]. Based on end-product profiles (Figure  1), carbon flux is preferentially channelled through POR. C. thermocellum encodes two 4-subunit PORs. While the γ, δ, α, and β subunits encoded by the gene cluster Cthe_2390-2393 are highly expressed, proteins encoded

by Cthe_2794-2797 are not detected by 2D-HPLC-MS/MS, in agreement with mRNA profiles reported by Raman et al.[37] and Fong et al.[80]. This contrasted with RT-PCR experiments performed by Carere et al., who reported high expression of subunit Cthe_2796 and low expression of subunit Cthe_2392 in exponential phase cultures grown on cellulose [22]. Three putative single subunit POR-like oxidoreductases, including Cthe_3120, a putative pyruvate:flavodoxin oixidoreductase, Cthe_0866, a putative 2-oxogluterate synthase, and Cthe_0614, a putative indolepyruvate:fd oxidoreuctase, were also detected at high levels using 2D-HPLC-MS/MS. In agreement with our relative protein abundance profiles, RT-PCR experiments have confirmed high expression levels of Cthe_3120 [22].

Electrode location, reference contraction, and normalization procedure conformed to recommendations by Mathiassen et al. (1995). To study any changes in muscle activation of relevance in everyday activities as a result of taking part in one of the two interventions, we chose to record sEMG from the trapezius muscle while the subject performed different

tasks representing gross motor movements with and without precision demand, a stress-inducing task, as well as the standardized domestic work task in randomized order. The global 10th percentile of the sEMG Poziotinib while performing these tests was chosen to represent the muscle activity and illustrate changes seen from baseline to the follow-ups. Statistical check details analysis Descriptive statistics for the entire study population, as well as stratified for each intervention group, were calculated at baseline. The change from baseline to first and second follow-up was compared. The association

between work ability and decreased pain or decreased Selleck MAPK inhibitor muscle activity between different occasions was also assessed. For non-normally distributed data, Wilcoxon’s signed rank test was used and for normally distributed data, Student’s t-test for dependent observation was used. Participants with decreased pain and decreased muscle activity

were selected and this website the change in work ability between baseline and first, as well as second, follow-up was calculated. The dichotomizations of decreased pain and muscle activity resulted in too few participants in each intervention group; thus, the entire study population was compared. All results with P value < 0.05 were considered statistically significant. Longitudinal analysis for repeated measurements with an unstructured covariance matrix was used to assess change between groups over time for WAI items and neck pain (Fitzmaurice et al. 2004). The program PROC MIXED in SAS, version 9.1 (SAS Inc., Cary, NC, USA), was used to implement the analysis method. Data for accessing WAI items and neck pain were considered normally distributed. All statistical analysis was performed using SAS, version 9.1 (Incorporated SI 2004). Results Work ability, health, and pain Self-rated work ability At baseline, the intervention groups did not differ in any self-rated measures (P < 0.05). Most subjects (n = 50, 80%) were classified as having poor work ability (Table 1). The mean values of work ability were low in all groups at baseline (Table 2). Among the whole study group, all self-rated dimensions of work ability increased during the study period (Table 2).

2004; Bloom and Chatterji 2009; Chowdhury and Santos 2010; Dees 2009; Smith and Stevens 2010). The latter define upscaling as increasing the impact produced by a social-purpose organization to better match the magnitude of the social need or problem it seeks to address. They distinguish upscaling and deep Ferrostatin-1 clinical trial scaling. Upscaling refers to the growth in social value by expanding a current program to other geographic locations. This involves effort and costs in terms of building infrastructure, organizing and developing an ecosystem, obtaining licenses, and educating customers in a new region. Deep scaling refers to focusing energies and resources on achieving greater impact in the

same location where the enterprise was started by engaging in activities like improving the quality of services, achieving greater penetration of the target population, learn more finding new ways to serve people, extending services to new people, and developing innovative financial management approaches. Karamchandani

et al. (2009) and Klein (2008) have a somewhat different view. They refer to upscaling as the capacity of the enterprise to expand quickly, effectively, and efficiently. Upscaling can also mean expanding the capacity of the existing business, in the sense of developing resources, building a knowledge base, employing people, developing management systems, and even developing a culture. According to them, upscaling, thus, includes serving more people with the same product within the same region, as well as extending into new markets, i.e., different geographies. In a given situation, the meaning

of upscaling, to a large extent, depends on the motivation of the entrepreneur. Some enterprises may focus on developing a specific region in terms of new products and services before scaling geographically, while others may choose to scale into new geographies before venturing into new products and services. According to Dees et al. (2004), choosing the right path towards broader social impact is a complex MI-503 clinical trial matter, since it involves judgment, experimentation, and continuous learning. They develop an approach towards upscaling based on following five Rs, i.e., Readiness, Resources, Receptivity, Risk, and Return. Bloom and Chatterji (2009) buy RG7420 suggest the SCALERS model, i.e., Staffing, Communicating, Alliance-building, Lobbying, Earnings-generation, Replicating, and Stimulating market forces. Chowdhury and Santos (2010) suggest that successful upscaling can be achieved by disseminating information through the use of best-practice blueprints or intermediaries such as multilateral organizations and consulting firms. Since our study is set in an emerging economy with deep-rooted social inequality and poverty in addition to environmental problems, it is pertinent to also examine the literature about development projects, program, and non-governmental organizations (NGOs) for possibly useful insights about upscaling.